NEETshala
Log in Get Started Free

Botany MCQs for NEET — Practice Questions with Answers

Practice free Botany NEET multiple-choice questions online with instant answers and detailed explanations. No login required.

All Physics Chemistry Botany Zoology
Register free to filter questions
● ● ● ● ●

Two plants can be conclusively said to belong to the same species if they (CBSE-2007)

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Two plants are conclusively said to belong to the same species if they can reproduce freely with each other and form seeds. This is because being able to reproduce and produce fertile offspring is a crucial criterion for defining a species. It ensures that the genetic material can be exchanged and maintained within the population.

● ● ● ● ●

Common name and genus are same in (PMT-07)

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

Branch connected with nomenclature,identification and classification is called

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Taxonomy is the branch of science concerned with classification, especially of organisms; systematics. It involves the identification, naming, and categorization of species based on shared characteristics and genetic relationships.

● ● ● ● ●

Who is the “Father of Taxonomy” among the following ?

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

Example of blue green algae is included in

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

The given mRNA sequence codes for a polypeptide. This polypeptide will contain how many different amino acids?
5'AUGGUGGAGGUUUGGUAAUGGAGAAGGUAG 3'

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

AUG = Methionine
GUG, GUU = Valine
GAG = Glutamic acid
UGG = Tryptophan
At the sixth position, UAA is present which cause premature termination of polypeptide.

● ● ● ● ●

In which of the following kingdoms, bacteria and blue-green algae are included ?

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

Which one of the following is also called halophiles ?

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

Match the following. A (p) Archaea (q) Bacteria (r) Eukarya B (i) Cellwall is made up of either cellulose or Fungal-cellulose (ii) Cell walldoes not contain peptidoglycan (iii) Cellwall is made up of peptidoglycan

You've reached today's free limit of 20 questions. Log in to keep practising for free.
● ● ● ● ●

Viroids were discovered by

You've reached today's free limit of 20 questions. Log in to keep practising for free.

Ready to ace NEET?

Free access · No credit card required

Browse All Questions Create Free Account

Frequently Asked Questions

Yes. You can attempt every Botany question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.

No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.

The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.