Practice free NEET NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
In cockroach, excretion is brought about by:
A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands
Urecose gland, nephrocytes and fat body are excretory; phallic and collaterial are reproductive accessory.
If the sequence on the formed mRNA is 5' AUCGAUCGAUCGAUCGAUCG AUCG 3', which one of the following is the sequence on corresponding coding strand?
Coding strand = same as mRNA but with T replacing U, same 5′→3′ direction.
Match List I with List II:
| List I | List II |
|---|---|
| A. Logistic growth | I. Unlimited resource availability condition |
| B. Exponential growth | II. Limited resource availability condition |
| C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same |
Logistic → limited; Exponential → unlimited; Expanding pyramid → pre-rep largest; Stable pyramid → pre-rep ≈ rep.
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Anal styles are present only in male cockroaches.
The unique mammalian characteristics are:
Hair, pinna (external ear), and mammary glands are unique to mammals.
Select the correct statements.
A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous chromosome.
Tetrad forms in Pachytene (not Leptotene); terminalization in Diakinesis; CO between NON-sister chromatids. B (Anaphase II) and D correct.
Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs. B. Basophils secrete histamine, serotonin and heparin. C. Basophils are involved in inflammatory response. D. Basophils have kidney shaped nucleus. E. Basophils are agranulocytes.
Basophils are LEAST abundant, granular, with lobed nucleus. Only B and C correct.
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
Limbic system + hypothalamus regulate emotion, motivation and sexual behaviour.
Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR.
A wrong (fluid loss ACTIVATES osmoreceptors). E wrong (ADH doesn't lower GFR). B, C, D correct.
Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere.
D wrong — sarcomere is between two Z-lines, not the M-line.
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every NEET question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.