Practice free NEET NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
The smallest unit of classification is (GGSPU-2002)
The smallest unit of classification is the species. A species is defined as a group of individuals that actually or potentially interbreed in nature. It is the most specific level of organism classification and contains organisms that are very closely related.
Basic unit of classification of organisms is (CET-2003)
The basic unit of classification in biological taxonomy is the 'species.' Species are groups of organisms that can interbreed and produce fertile offspring. This concept is fundamental in biology and helps in identifying and categorizing the vast diversity of life on Earth.
Two plants can be conclusively said to belong to the same species if they (CBSE-2007)
Two plants are conclusively said to belong to the same species if they can reproduce freely with each other and form seeds. This is because being able to reproduce and produce fertile offspring is a crucial criterion for defining a species. It ensures that the genetic material can be exchanged and maintained within the population.
Common name and genus are same in (PMT-07)
Branch connected with nomenclature,identification and classification is called
Taxonomy is the branch of science concerned with classification, especially of organisms; systematics. It involves the identification, naming, and categorization of species based on shared characteristics and genetic relationships.
Who is the “Father of Taxonomy†among the following ?
Example of blue green algae is included in
The given mRNA sequence codes for a polypeptide. This polypeptide will contain how many different amino acids?
5'AUGGUGGAGGUUUGGUAAUGGAGAAGGUAG 3'
AUG = Methionine
GUG, GUU = Valine
GAG = Glutamic acid
UGG = Tryptophan
At the sixth position, UAA is present which cause premature termination of polypeptide.
In which of the following kingdoms, bacteria and blue-green algae are included ?
Which one of the following is also called halophiles ?
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every NEET question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.