Practice free Molecular Basis of Inheritance (Botany) NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
The total number of nitrogenous bases in human genome is estimated to be about (AIIMS 2004)
The total number of nitrogenous bases in human genomes estimated were 3.1 billion.
The given mRNA sequence codes for a polypeptide. This polypeptide will contain how many different amino acids?
5'AUGGUGGAGGUUUGGUAAUGGAGAAGGUAG 3'
AUG = Methionine
GUG, GUU = Valine
GAG = Glutamic acid
UGG = Tryptophan
At the sixth position, UAA is present which cause premature termination of polypeptide.
Name the conjugated protein used as genetic material in living cells
Nucleoproteins are conjugated proteins that include nucleic acids, which serve as the genetic material in living cells. These proteins play a crucial role in the storage and expression of genetic information.
Who supported Griffith effect by molecular explanation ?
Avery, McCarty, and MacLeod provided molecular evidence supporting Griffith's experiment. They demonstrated that DNA is the substance that causes bacterial transformation, thereby identifying DNA as the genetic material.
Synthesis of nucleic acids always takes place in
The synthesis of nucleic acids, including DNA and RNA, always occurs in the 5' to 3' direction. This is because DNA polymerases and RNA polymerases add nucleotides to the 3' end of the growing chain.
DNA Chain initiation phase during replication is
During DNA replication, the initiation phase involves the formation of the replication fork. This is where the DNA double helix is unwound, allowing each strand to be copied.
What is called Griffith effect ?
The Griffith effect, also known as bacterial transformation, refers to the process where one strain of bacteria is changed by a gene or genes from another strain of bacteria. This was first demonstrated by Frederick Griffith in 1928.
Genetic information is carried by the long chain molecules which are made up of
Genetic information is carried by long chain molecules called nucleotides. These nucleotides form the structure of DNA and RNA, which store and transmit genetic information.
By which bonds the purine & pyrimidine pairs of Complementary Strands of DNA held together?
The purine and pyrimidine pairs of complementary strands of DNA are held together by hydrogen bonds (H-bonds). In DNA, adenine (a purine) pairs with thymine (a pyrimidine) with the help of 2 hydrogen bonds, and guanine (a purine) pairs with cytosine (a pyrimidine) with the help of 3 hydrogen bonds. This hydrogen bonding is crucial for the stability and specificity of the DNA double helix structure.
State the nature of the 2 Strands of DNA duplex.
The two strands of the DNA duplex are antiparallel and complementary. 'Antiparallel' means that the two strands run in opposite directions, which is essential for the base pairs to align properly and form hydrogen bonds. 'Complementary' means that each base on one strand pairs with a specific base on the opposite strand (A with T, and G with C).
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every Molecular Basis of Inheritance question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.