Practice free Zoology NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
Anal cerci arise from the 10th abdominal segment in both male and female cockroaches.
Match List I with List II:
| List I | List II |
|---|---|
| A. Down's syndrome | I. $11^{\text{th}}$ chromosome |
| B. $\alpha$-Thalassemia | II. 'X' chromosome |
| C. $\beta$-Thalassemia | III. $21^{\text{st}}$ chromosome |
| D. Klinefelter's syndrome | IV. $16^{\text{th}}$ chromosome |
Choose the correct answer from the options given below:
Down — trisomy 21; $\alpha$-thal — chr 16; $\beta$-thal — chr 11; Klinefelter — extra X (XXY).
Which of the following is not a natural/traditional contraceptive method?
Vaults are a barrier (artificial) contraceptive; the rest are natural methods.
Which of the following are Autoimmune disorders?
A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
Gout is a metabolic disorder; muscular dystrophy is genetic. Myasthenia gravis, rheumatoid arthritis and SLE are classical autoimmune diseases.
Which of the following statements is incorrect?
Bioreactors are designed for large-scale production (typically 100–1000 L or more), not small-scale cultures.
Match List I with List II:
| List I | List II |
|---|---|
| A. Non-medicated IUD | I. Multiload 375 |
| B. Copper releasing IUD | II. Progestogens |
| C. Hormone releasing IUD | III. Lippes loop |
| D. Implants | IV. LNG-20 |
Choose the correct answer from the options given below:
Lippes loop — non-medicated; Multiload 375 — Cu IUD; LNG-20 — hormone IUD; Implants — progestogens.
Which one is the correct product of DNA dependent RNA polymerase to the given template? $3'\text{ TACATGGCAAATATCCATTCA }5'$
RNA is complementary and antiparallel to the template; T → A and the new strand uses U instead of T.
Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
Brain stem = medulla + pons + midbrain (not cerebrum). Statement II is incorrect.
Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition the inferior will be eliminated. This may be true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below:
Both reflect Gause's competitive exclusion concept as stated in NCERT.
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. (Flow: GnRH → LH (left arm) → (B) → Androgens; GnRH → (A) (right arm) → (C) → Factors → (D) = Formation of spermatids.)
GnRH triggers LH and FSH (A). LH acts on Leydig (interstitial) cells (B) → androgens. FSH acts on Sertoli cells (C) → factors → spermiogenesis (D).
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every Zoology question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.