Zoology MCQs for NEET — Practice Questions with Answers

Practice free Zoology NEET multiple-choice questions online with instant answers and detailed explanations. No login required.

All Physics Chemistry Botany Zoology
Language English हिंदी
Register free for difficulty & keyword filters
NEET 2024

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Anal cerci arise from the 10th abdominal segment in both male and female cockroaches.

NEET 2024

Match List I with List II:

List I List II
A. Down's syndrome I. $11^{\text{th}}$ chromosome
B. $\alpha$-Thalassemia II. 'X' chromosome
C. $\beta$-Thalassemia III. $21^{\text{st}}$ chromosome
D. Klinefelter's syndrome IV. $16^{\text{th}}$ chromosome

Choose the correct answer from the options given below:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Down — trisomy 21; $\alpha$-thal — chr 16; $\beta$-thal — chr 11; Klinefelter — extra X (XXY).

NEET 2024

Which of the following is not a natural/traditional contraceptive method?

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Vaults are a barrier (artificial) contraceptive; the rest are natural methods.

NEET 2024

Which of the following are Autoimmune disorders?

A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Gout is a metabolic disorder; muscular dystrophy is genetic. Myasthenia gravis, rheumatoid arthritis and SLE are classical autoimmune diseases.

NEET 2024

Which of the following statements is incorrect?

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Bioreactors are designed for large-scale production (typically 100–1000 L or more), not small-scale cultures.

NEET 2024

Match List I with List II:

List I List II
A. Non-medicated IUD I. Multiload 375
B. Copper releasing IUD II. Progestogens
C. Hormone releasing IUD III. Lippes loop
D. Implants IV. LNG-20

Choose the correct answer from the options given below:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Lippes loop — non-medicated; Multiload 375 — Cu IUD; LNG-20 — hormone IUD; Implants — progestogens.

NEET 2024

Which one is the correct product of DNA dependent RNA polymerase to the given template? $3'\text{ TACATGGCAAATATCCATTCA }5'$

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

RNA is complementary and antiparallel to the template; T → A and the new strand uses U instead of T.

NEET 2024

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Brain stem = medulla + pons + midbrain (not cerebrum). Statement II is incorrect.

NEET 2024

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below:

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

Both reflect Gause's competitive exclusion concept as stated in NCERT.

NEET 2024

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis. (Flow: GnRH → LH (left arm) → (B) → Androgens; GnRH → (A) (right arm) → (C) → Factors → (D) = Formation of spermatids.)

You've reached today's free limit of 20 questions. Log in to keep practising for free.
Explanation

GnRH triggers LH and FSH (A). LH acts on Leydig (interstitial) cells (B) → androgens. FSH acts on Sertoli cells (C) → factors → spermiogenesis (D).

Ready to ace NEET?

Free access · No credit card required

Frequently Asked Questions

Yes. You can attempt every Zoology question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.

No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.

The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.