Practice free Zoology NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
Match List I with List II:
| List I | List II |
|---|---|
| A. Taenia | I. Nephridia |
| B. Paramoecium | II. Contractile vacuole |
| C. Periplaneta | III. Flame cells |
| D. Pheretima | IV. Urecose gland |
Taenia → flame cells; Paramecium → contractile vacuole; Cockroach → uricose gland; Earthworm → nephridia.
Match List I with List II:
| List I | List II |
|---|---|
| A. Heroin | I. Effect on cardiovascular system |
| B. Marijuana | II. Slow down body function |
| C. Cocaine | III. Painkiller |
| D. Morphine | IV. Interfere with transport of dopamine |
Heroin slows; Marijuana affects CVS; Cocaine blocks dopamine reuptake; Morphine → analgesic.
Which of the following statements is correct?
Biomagnification: a toxicant becomes more concentrated up the food chain.
Match List I with List II:
| List I (Cells) | List II (Secretion) |
|---|---|
| A. Peptic cells | I. Mucus |
| B. Goblet cells | II. Bile juice |
| C. Oxyntic cells | III. Proenzyme pepsinogen |
| D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin B₁₂ |
Peptic → pepsinogen; Goblet → mucus; Oxyntic/parietal → HCl + IF; Hepatic → bile.
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
Both anatomical statements are accurate per NCERT.
Vital capacity of lung is _____.
VC = IRV + TV + ERV (max air expired after max inspiration).
Match List I with List II with respect to human eye:
| List I | List II |
|---|---|
| A. Fovea | I. Visible coloured portion of eye that regulates diameter of pupil |
| B. Iris | II. External layer of eye formed of dense connective tissue |
| C. Blind spot | III. Point of greatest visual acuity or resolution |
| D. Sclera | IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent |
Fovea → acuity; Iris → pupil control; Blind spot → no photoreceptors; Sclera → outer dense CT.
In cockroach, excretion is brought about by:
A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands
Urecose gland, nephrocytes and fat body are excretory; phallic and collaterial are reproductive accessory.
If the sequence on the formed mRNA is 5' AUCGAUCGAUCGAUCGAUCG AUCG 3', which one of the following is the sequence on corresponding coding strand?
Coding strand = same as mRNA but with T replacing U, same 5′→3′ direction.
Match List I with List II:
| List I | List II |
|---|---|
| A. Logistic growth | I. Unlimited resource availability condition |
| B. Exponential growth | II. Limited resource availability condition |
| C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same |
Logistic → limited; Exponential → unlimited; Expanding pyramid → pre-rep largest; Stable pyramid → pre-rep ≈ rep.
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every Zoology question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.