Practice free Biotechnology Principles and Processes (Zoology) NEET multiple-choice questions online with instant answers and detailed explanations. No login required.
Match List I with List II:
| List I (Lac operon gene) | List II (Product) |
|---|---|
| A. Gene 'a' | I. β-galactosidase |
| B. Gene 'y' | II. Transacetylase |
| C. Gene 'i' | III. Permease |
| D. Gene 'z' | IV. Repressor protein |
a → transacetylase, y → permease, i → repressor, z → β-galactosidase.
If the sequence on the formed mRNA is 5' AUCGAUCGAUCGAUCGAUCG AUCG 3', which one of the following is the sequence on corresponding coding strand?
Coding strand = same as mRNA but with T replacing U, same 5′→3′ direction.
The "Ti plasmid" of Agrobacterium tumefaciens stands for:
Ti = Tumour-inducing — it produces crown gall tumours in dicots; modified Ti is used as a plant gene-transfer vector.
The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:
On the NCERT pBR322 map, X (rop) codes for a protein involved in plasmid replication; Y (tet) confers tetracycline resistance.
Which of the following statements is incorrect?
Bioreactors are designed for large-scale production (typically 100–1000 L or more), not small-scale cultures.
Which one is the correct product of DNA dependent RNA polymerase to the given template? $3'\text{ TACATGGCAAATATCCATTCA }5'$
RNA is complementary and antiparallel to the template; T → A and the new strand uses U instead of T.
Match List I with List II:
| List I | List II |
|---|---|
| A. RNA polymerase III | I. snRNPs |
| B. Termination of transcription | II. Promoter |
| C. Splicing of Exons | III. Rho factor |
| D. TATA box | IV. snRNAs, tRNA |
Choose the correct answer from the options given below:
RNA pol III makes tRNA, 5S rRNA, snRNAs; Rho terminates prokaryotic transcription; snRNPs splice introns; TATA is in eukaryotic promoter.
Polymerase chain reaction (PCR) amplifies DNA following the equation:
Each PCR cycle doubles the target DNA, so after $n$ cycles the number of copies is $2^n$ (exponential amplification).
In the represented plasmid an alien piece of DNA is inserted at the EcoRI site. Which of the following strategies will be chosen to select the recombinant colonies?
Inserting DNA at the EcoRI site within the β-galactosidase (lacZ) gene inactivates it (insertional inactivation). Recombinants cannot hydrolyse the chromogenic substrate, so they form white colonies; non-recombinants form blue colonies.
Identify the part of a bio-reactor which is used as a foam breaker from the given figure.
The foam breaker is the uppermost component (B) of the stirred-tank bioreactor; it controls/breaks the foam formed during aeration and agitation.
Ready to ace NEET?
Free access · No credit card required
Yes. You can attempt every Biotechnology Principles and Processes question on this page for free without logging in, and check the correct answer with a detailed explanation instantly.
No account is required to attempt questions and view answers. A free account adds bookmarks, personal notes, and progress tracking.
The bank mixes NEET previous year questions (PYQs) with practice questions, each tagged with its exam appearances where applicable.